-
PurposeThis plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50515 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGZ21dxZ
-
Backbone manufacturerYamada Lab, Tamura et al., Science 280: 1614-7 (1998)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameprotein tyrosine kinase
-
Alt nameFAK
-
Alt namePTK2
-
SpeciesM. musculus (mouse)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GFP FW (AAAGACCCCAACGAGAAGCG)
- 3′ sequencing primer GFP ASO (TTGTAACCATTATAAGCTGC) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Fluorophore encoded by this plasmid is ABB59962.1 with G66A.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGFP FAK was a gift from Kenneth Yamada (Addgene plasmid # 50515 ; http://n2t.net/addgene:50515 ; RRID:Addgene_50515) -
For your References section:
Shc and FAK differentially regulate cell motility and directionality modulated by PTEN. Gu J, Tamura M, Pankov R, Danen EH, Takino T, Matsumoto K, Yamada KM. J Cell Biol. 1999 Jul 26;146(2):389-403. 10.1083/jcb.146.2.389 PubMed 10427092