pmyr GFP
(Plasmid
#50528)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50528 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonemodified pGZ21dXZ
-
Backbone manufacturerYamada Lab
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemembrane marker
-
Alt namemyristylated GFP
- Promoter CMV
-
Tag
/ Fusion Protein
- Src myristylation signal (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer pRKKZ FW (TAGAATAACATCCACTTTGCC) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
GFP localized to cell membrane
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmyr GFP was a gift from Kenneth Yamada (Addgene plasmid # 50528 ; http://n2t.net/addgene:50528 ; RRID:Addgene_50528)