Skip to main content

pGFP Cas
(Plasmid #50729)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50729 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGZ21dxZ
  • Backbone manufacturer
    Yamada Lab
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas
  • Alt name
    breast cancer anti-estrogen resistance 1
  • Alt name
    p130Cas
  • Alt name
    Bcar1
  • Species
    R. norvegicus (rat)
  • Entrez Gene
    Bcar1 (a.k.a. Cas, Crkas, P130CAS)
  • Promoter CMV
  • Tags / Fusion Proteins
    • GFP (N terminal on backbone)
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer GFP FW (AAAGACCCCAACGAGAAGCG)
  • 3′ sequencing primer GFP ASO (TTGTAACCATTATAAGCTGC)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    cDNA was obtained from Dr. Hisamaru Hirai (Univ of Tokyo).
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGFP Cas was a gift from Kenneth Yamada (Addgene plasmid # 50729 ; http://n2t.net/addgene:50729 ; RRID:Addgene_50729)