pRS316-RGR-GFP-mHH
(Plasmid
#51057)
-
PurposeSame as pRS316-RGR-GFP except for the HH ribozyme region which has a 13 bp deletion at its 5' end.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51057 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRS316
- Backbone size w/o insert (bp) 4887
- Total vector size (bp) 5841
-
Modifications to backboneYeast ADH1 promoter and ADH1 terminator were cloned in between the BamHI and EcoRI site, and RGR-GFP-mHH gene was inserted inbetween the ADH1 promoter and terminator.
-
Vector typeBacterial Expression, Yeast Expression, CRISPR
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRGR-GFP
-
SpeciesSynthetic
-
Insert Size (bp)198
- Promoter Yeast ADH1 promoter
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CCTCGTCATTGTTCTCGTTCC
- 3′ sequencing primer ACGTATCTACCAACGATTTGACC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS316-RGR-GFP-mHH was a gift from Yunde Zhao (Addgene plasmid # 51057 ; http://n2t.net/addgene:51057 ; RRID:Addgene_51057) -
For your References section:
Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing. Gao Y, Zhao Y. J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152. 10.1111/jipb.12152 PubMed 24373158