-
PurposeForebrain principle neuron specific expression of GCaMP6s Ca sensor and physically separate nuclear localized dTomato fluorophore
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51086 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-CaMKIIa-WPRE-BGHpA
-
Backbone manufacturercustom
- Backbone size w/o insert (bp) 5095
- Total vector size (bp) 7255
-
Modifications to backboneAltered cloning sites and replaced HGHpA with smaller BGHpA
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGCaMP6s
-
Alt nameG6s
-
Alt nameGCaMP6 slow
-
SpeciesSynthetic
-
Insert Size (bp)2160
- Promoter CaMKIIa 1.3 kb
-
Tag
/ Fusion Protein
- P2A-nls-dTomato (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer ttctccgtttgcactcaggagc
- 3′ sequencing primer CCATACGGGAAGCAATAGCATG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe GCaMP6s portion was derived from Addgene plasmid #40753 (Douglas Kim, Janelia Farms).
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The addition of the P2A-nls-dTomato allows for easy identification of GCaMP6 expressing cells exhibiting nuclear red fluorescence that does not significantly overlap with the cytosolic GCaMP signal. The GCaMP and fluorophore are physically uncoupled.
Permissions were obtained from Douglas Kim and the Clontech licensing office for depositing this new plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-CaMKIIa-GCaMP6s-P2A-nls-dTomato was a gift from Jonathan Ting (Addgene plasmid # 51086 ; http://n2t.net/addgene:51086 ; RRID:Addgene_51086)