CMV-CC2
(Plasmid
#51221)
-
Purposeexpression of amino acid 917-1040 of chicken DCTN1 p150Glued in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51221 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGW1-CMV
- Backbone size w/o insert (bp) 4800
- Total vector size (bp) 5200
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDCTN1
-
Alt namep150Glued
-
SpeciesG. gallus (chicken)
-
Insert Size (bp)372
-
Mutationaa917-1040
-
Entrez GeneDCTN1 (a.k.a. Chip150)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer CGTGCCATGGCCGAGCTGCGGGCAGCTGC
- 3′ sequencing primer CCGGGATCCTTACCCCTCGATGGTCCGCTTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-CC2 was a gift from Trina Schroer (Addgene plasmid # 51221 ; http://n2t.net/addgene:51221 ; RRID:Addgene_51221) -
For your References section:
Dynactin is required for microtubule anchoring at centrosomes. Quintyne NJ, Gill SR, Eckley DM, Crego CL, Compton DA, Schroer TA. J Cell Biol. 1999 Oct 18;147(2):321-34. 10.1083/jcb.147.2.321 PubMed 10525538
Map uploaded by the depositor.