Skip to main content
Addgene

3xFLAG-dCas9/pMXs-neo
(Plasmid #51260)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51260 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMXs-neo
  • Backbone manufacturer
    Hodaka Fujii
  • Backbone size w/o insert (bp) 6238
  • Total vector size (bp) 10450
  • Vector type
    Mammalian Expression, Retroviral, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    3xFLAG-dCas9
  • Species
    Synthetic
  • Insert Size (bp)
    4212
  • Mutation
    human codon-optimized, D10A + H840A
  • Promoter LTR
  • Tags / Fusion Proteins
    • 3xFLAG tag (N terminal on insert)
    • NLS (nuclear localization signal) (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Pac I (not destroyed)
  • 3′ cloning site Not I (not destroyed)
  • 5′ sequencing primer ggtggaccatcctctagact
  • 3′ sequencing primer tggggactttccacaccctaactgacacacat
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The coding sequence of 3xFLAG-dCas9 can be cleaved with Pac I and Not I.

Construction strategy of gRNA retroviral vectors
1. Cleave gBlock from a gRNA vector constructed using gRNA cloning vector (Addgene #41824) with appropriate restriction enzymes (eg. [Xho I + Hind III], EcoR I).
2. Insert the cleaved gBlock into pSIR-based self-inactivating retroviral vectors.
Vectors & Sites of insertion
pSIR-neo (Addgene #51128): eg. [Xho I + Hind III]
pSIR-GFP (Addgene #51134): eg. [Xho I + Hind III], EcoR I
pSIR-DsRed-Express2 (Addgene #51135): eg. [Xho I + Hind III], EcoR I
pSIR-hCD2 (Addgene #51143): eg. EcoR I

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    3xFLAG-dCas9/pMXs-neo was a gift from Hodaka Fujii (Addgene plasmid # 51260 ; http://n2t.net/addgene:51260 ; RRID:Addgene_51260)
  • For your References section:

    Identification of Proteins Associated with an IFNgamma-Responsive Promoter by a Retroviral Expression System for enChIP Using CRISPR. Fujita T, Fujii H. PLoS One. 2014 Jul 22;9(7):e103084. doi: 10.1371/journal.pone.0103084. eCollection 2014. 10.1371/journal.pone.0103084 PubMed 25051498