Skip to main content

pCAG-attBr-Cre-rc-attP
(Plasmid #51264)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51264 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDIRECT
  • Backbone manufacturer
    CLONTECH
  • Backbone size w/o insert (bp) 4814
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    attBr-Cre-rc-attP
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Esp3I (destroyed during cloning)
  • 3′ cloning site Esp3I (destroyed during cloning)
  • 5′ sequencing primer CATGCCTTCTTCTTTTTCCTAC
  • 3′ sequencing primer GGAAAGGACAGTGGGAGTGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the complementary plasmid pCAG-NLS-HA-Bxb1 (www.addgene.org/51271) must be ordered with pCAG-attBr-Cre-rc-attP in order to successfully use the Bxb1-Cre recombinase system as described in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-attBr-Cre-rc-attP was a gift from Pawel Pelczar (Addgene plasmid # 51264 ; http://n2t.net/addgene:51264 ; RRID:Addgene_51264)
  • For your References section:

    Binary recombinase systems for high-resolution conditional mutagenesis. Hermann M, Stillhard P, Wildner H, Seruggia D, Kapp V, Sanchez-Iranzo H, Mercader N, Montoliu L, Zeilhofer HU, Pelczar P. Nucleic Acids Res. 2014 Jan 9. 10.1093/nar/gkt1361 PubMed 24413561