-
PurposeComponent of the Co-Driver binary site-specific recombinase system, generates functional rox60-71Cre upon removal of an internal STOP cassette by Dre
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51273 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDIRECT
-
Backbone manufacturerCLONTECH
- Backbone size w/o insert (bp) 4814
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl2
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRoxed-Cre
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Esp3I (destroyed during cloning)
- 3′ cloning site Esp3I (destroyed during cloning)
- 5′ sequencing primer CATGCCTTCTTCTTTTTCCTAC
- 3′ sequencing primer GGAAAGGACAGTGGGAGTGGC
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the complementary plasmid pCAG-NLS-HA-Dre (www.addgene.org/51272) must be ordered with pCAG-Roxed-Cre in order to successfully use the Co-Driver recombinase system as described in the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-Roxed-Cre was a gift from Pawel Pelczar (Addgene plasmid # 51273 ; http://n2t.net/addgene:51273 ; RRID:Addgene_51273) -
For your References section:
Binary recombinase systems for high-resolution conditional mutagenesis. Hermann M, Stillhard P, Wildner H, Seruggia D, Kapp V, Sanchez-Iranzo H, Mercader N, Montoliu L, Zeilhofer HU, Pelczar P. Nucleic Acids Res. 2014 Jan 9. 10.1093/nar/gkt1361 PubMed 24413561