Skip to main content

pLVX-3XMyc-mTrim25
(Plasmid #51394)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51394 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLVX
  • Backbone manufacturer
    Clontech (modified)
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Trim25
  • Alt name
    EFP
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Trim25 (a.k.a. EFP, Zfp147)
  • Promoter EF1alpha
  • Tag / Fusion Protein
    • 3XMyc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer ccacactgagtgggtggagac
  • 3′ sequencing primer GGTGGATGTGGAATGTGTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

AK154543 (except for K238E (SNP)). For vector modification, we first inserted new multi cloning sites (MCS) between EcoRI and BamHI sites of pLVX-EF1a-AcGFP1-N1 (Clontech, 631983). Next, we removed coding sequences of AcGFP from the above vector by using XbaI sites, and inserted new sequences comprised of Kozak-ATG-3XMyc between BamHI and EcoRI sites.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVX-3XMyc-mTrim25 was a gift from Narry Kim (Addgene plasmid # 51394 ; http://n2t.net/addgene:51394 ; RRID:Addgene_51394)
  • For your References section:

    The RNA-binding protein repertoire of embryonic stem cells. Kwon SC, Yi H, Eichelbaum K, Fohr S, Fischer B, You KT, Castello A, Krijgsveld J, Hentze MW, Kim VN. Nat Struct Mol Biol. 2013 Sep;20(9):1122-30. doi: 10.1038/nsmb.2638. Epub 2013 Aug 4. 10.1038/nsmb.2638 PubMed 23912277