-
Depositing Lab
-
Depositing OrganizationSeoul National University
Located in the Republic of Korea -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51394 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLVX
-
Backbone manufacturerClontech (modified)
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTrim25
-
Alt nameEFP
-
SpeciesM. musculus (mouse)
-
Entrez GeneTrim25 (a.k.a. EFP, Zfp147)
- Promoter EF1alpha
-
Tag
/ Fusion Protein
- 3XMyc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer ccacactgagtgggtggagac
- 3′ sequencing primer GGTGGATGTGGAATGTGTGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
AK154543 (except for K238E (SNP)). For vector modification, we first inserted new multi cloning sites (MCS) between EcoRI and BamHI sites of pLVX-EF1a-AcGFP1-N1 (Clontech, 631983). Next, we removed coding sequences of AcGFP from the above vector by using XbaI sites, and inserted new sequences comprised of Kozak-ATG-3XMyc between BamHI and EcoRI sites.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX-3XMyc-mTrim25 was a gift from Narry Kim (Addgene plasmid # 51394 ; http://n2t.net/addgene:51394 ; RRID:Addgene_51394) -
For your References section:
The RNA-binding protein repertoire of embryonic stem cells. Kwon SC, Yi H, Eichelbaum K, Fohr S, Fischer B, You KT, Castello A, Krijgsveld J, Hentze MW, Kim VN. Nat Struct Mol Biol. 2013 Sep;20(9):1122-30. doi: 10.1038/nsmb.2638. Epub 2013 Aug 4. 10.1038/nsmb.2638 PubMed 23912277