Skip to main content
Addgene

pGL3Basic-ME.2/ApoEpromoter
(Plasmid #51436)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51436 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL3 Basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4818
  • Total vector size (bp) 6516
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    APOE apolipoprotein E
  • Alt name
    ME2 malic enzyme 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1698
  • Mutation
    The ME.2 enhancer is fused upstream of the ApoE gene promoter (-980/+93 bp)
  • Entrez Gene
    APOE (a.k.a. AD2, APO-E, ApoE4, LDLCQ5, LPG)
  • Entrez Gene
    ME2 (a.k.a. ODS1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
  • 3′ sequencing primer CTTTATGTTTTTGGCGTCTTCCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3Basic-ME.2/ApoEpromoter was a gift from Sohail Tavazoie (Addgene plasmid # 51436 ; http://n2t.net/addgene:51436 ; RRID:Addgene_51436)
  • For your References section:

    Broad-spectrum therapeutic suppression of metastatic melanoma through nuclear hormone receptor activation. Pencheva N, Buss CG, Posada J, Merghoub T, Tavazoie SF. Cell. 2014 Feb 27;156(5):986-1001. doi: 10.1016/j.cell.2014.01.038. 10.1016/j.cell.2014.01.038 PubMed 24581497