pGL3Basic-ME.2/ApoEpromoter
(Plasmid
#51436)
-
PurposeThis plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.2 enhancer
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51436 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGL3 Basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4818
- Total vector size (bp) 6516
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
- 3′ sequencing primer CTTTATGTTTTTGGCGTCTTCCA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3Basic-ME.2/ApoEpromoter was a gift from Sohail Tavazoie (Addgene plasmid # 51436 ; http://n2t.net/addgene:51436 ; RRID:Addgene_51436) -
For your References section:
Broad-spectrum therapeutic suppression of metastatic melanoma through nuclear hormone receptor activation. Pencheva N, Buss CG, Posada J, Merghoub T, Tavazoie SF. Cell. 2014 Feb 27;156(5):986-1001. doi: 10.1016/j.cell.2014.01.038. 10.1016/j.cell.2014.01.038 PubMed 24581497