pLSLGFP
(Plasmid #51494)

• Purpose: pLSL with GFP followed by the us:NPTII repair template, Rep is not included on this plasmid
• Depositing Lab: Daniel Voytas
• Depositing Organization: University of Minnesota
  Located in the United States of America
• Publication: Baltes et al Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792
• Citations:

  1 Article

Backbone

• Vector backbone: pCAMBIA1300
• Backbone size w/o insert (bp): 12921
• Total vector size (bp): 15157
• Modifications to backbone: cis-acting replicational elements from the bean yellow dwarf virus were added in an LIR-SIR-LIR orientation.
• Vector type: plant T-DNA plasmid
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: GFP
• Species: jellyfish
• Insert Size (bp): 912
• Promoter: virion-sense LIR and 2x35S
• Tags / Fusion Proteins:
  • NLS (N terminal on insert)
  • flag (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gateway Cloning
• 5′ sequencing primer: atggattataaggatcacgatg
• 3′ sequencing primer: taaagctcatcatgtttgtat

Gene/Insert 2

• Gene/Insert name: us:NPTII repair template
• Insert Size (bp): 2600

Cloning Information for Gene/Insert 2

• Cloning method: Gateway Cloning
• 5′ sequencing primer: agcagtcttacttccatgattt
• 3′ sequencing primer: taacatagatgacaccgcg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: I generated GFP and us:NPTII using other plasmids. us:NPTII was amplified using pDW1269 as a template. GFP was amplified using pTC23.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 51494-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 51494-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.