Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pLSLGFP.R
(Plasmid #51501)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51501 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAMBIA1300
  • Backbone size w/o insert (bp) 10531
  • Total vector size (bp) 12417
  • Vector type
    plant T-DNA plasmid
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP
  • Species
    jellyfish
  • Insert Size (bp)
    900
  • Promoter 2x35S

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PmlI (destroyed during cloning)
  • 3′ cloning site PmlI (destroyed during cloning)
  • 5′ sequencing primer atggtgagtaaaggagaaga
  • 3′ sequencing primer ttatttgtatagttcatccatg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GFP was amplified by PCR using pTC23 as a template.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note that there may be some minor discrepancies between Addgene's quality control sequence and the depositor's assembled sequence. These discrepancies are not in functionally relevant regions of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLSLGFP.R was a gift from Daniel Voytas (Addgene plasmid # 51501 ; http://n2t.net/addgene:51501 ; RRID:Addgene_51501)
  • For your References section:

    DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan 17. 10.1105/tpc.113.119792 PubMed 24443519