-
PurposeSingle component LSL vector with GFP. Rep is expressed from the complementary sense LIR promoter. GFP is between LIR and SIR and is driven from a 2X35S promoter. Rep is within the replicon
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51501 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAMBIA1300
- Backbone size w/o insert (bp) 10531
- Total vector size (bp) 12417
-
Vector typeplant T-DNA plasmid
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP
-
Speciesjellyfish
-
Insert Size (bp)900
- Promoter 2x35S
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PmlI (destroyed during cloning)
- 3′ cloning site PmlI (destroyed during cloning)
- 5′ sequencing primer atggtgagtaaaggagaaga
- 3′ sequencing primer ttatttgtatagttcatccatg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGFP was amplified by PCR using pTC23 as a template.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note that there may be some minor discrepancies between Addgene's quality control sequence and the depositor's assembled sequence. These discrepancies are not in functionally relevant regions of the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLSLGFP.R was a gift from Daniel Voytas (Addgene plasmid # 51501 ; http://n2t.net/addgene:51501 ; RRID:Addgene_51501) -
For your References section:
DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan 17. 10.1105/tpc.113.119792 PubMed 24443519