-
PurposepMDC32 with Rep/RepA coding sequence from the mild bean yellow dwarf virus
-
Depositing Lab
-
Depositing OrganizationUniversity of Minnesota
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51491 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 51491-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 51491-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepMDC32
- Backbone size w/o insert (bp) 10000
- Total vector size (bp) 11216
-
Vector typeplant expression T-DNA
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRep/RepA
-
Speciesbean yellow dwarf virus
-
Insert Size (bp)1000
-
Mutationnone
-
GenBank IDDQ458791
- Promoter 2x35S
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer atgccttctgctagtaagaactt
- 3′ sequencing primer aggcacgttcagtgactcga
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byI did not originally clone this gene. The coding sequence for Rep and RepA was synthesized on g-Blocks from IDT.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 51491-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 51491-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pREP was a gift from Daniel Voytas (Addgene plasmid # 51491 ; http://n2t.net/addgene:51491 ; RRID:Addgene_51491) -
For your References section:
DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792 10.1105/tpc.113.119792 PubMed 24443519