Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #51500)


Item Catalog # Description Quantity Price (USD)
Plasmid 51500 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size (bp) 10531
  • Modifications to backbone
    cis-acting replicational elements from the bean yellow dwarf virus were added in an LIR-SIR-Rep/RepA-LIR orientation.
  • Vector type
    plant T-DNA plasmid
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer tcccactgacttgaagtacac
  • 3′ sequencing primer ggacttgtttagagtttcta
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Cis-acting elements were amplified from pLSL. The Rep/RepA coding sequence was amplified from pREP.
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Due to the repeat regions in this plasmid, Addgene was unable to obtain very much sequence for quality control purposes. The depositing lab recommends performing a diagnostic digest before using.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLSLR was a gift from Daniel Voytas (Addgene plasmid # 51500 ; ; RRID:Addgene_51500)
  • For your References section:

    DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan 17. 10.1105/tpc.113.119792 PubMed 24443519