p35SZ.D
(Plasmid
#51512)
-
PurposepMDC32 with Zif268:FokI followed by us:NPTII repair template sequence
-
Depositing Lab
-
Depositing OrganizationUniversity of Minnesota
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51512 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMDC32
- Backbone size w/o insert (bp) 11752
- Total vector size (bp) 13973
-
Vector typeplant expression T-DNA
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameZif268:FokI
-
Speciesfusion between human and bacterial genes
-
Insert Size (bp)897
- Promoter 2x35S
-
Tag
/ Fusion Protein
- NLS (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer atggcttcctcccctccaaaga
- 3′ sequencing primer ctattaaaagtttatctcaccg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameus:NPTII repair template
-
Insert Size (bp)2600
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer agcagtcttacttccatgatttc
- 3′ sequencing primer tcagaagaactcgtcaagaa
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byZif268:FokI was amplified by PCR using pDW1345 as a template. This sequence was cloned into pNJB91. us:nptII repair template was amplified by PCR using pDW1269 as a template. This sequence was cloned into pNJB80. pNJB80 and pNJB91 with these two inserts were used in a multi-site Gateway reaction with pMDC32.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p35SZ.D was a gift from Daniel Voytas (Addgene plasmid # 51512 ; http://n2t.net/addgene:51512 ; RRID:Addgene_51512) -
For your References section:
DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792 10.1105/tpc.113.119792 PubMed 24443519