Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p35SZ.D
(Plasmid #51512)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51512 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMDC32
  • Backbone size w/o insert (bp) 11752
  • Total vector size (bp) 13973
  • Vector type
    plant expression T-DNA
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Zif268:FokI
  • Species
    fusion between human and bacterial genes
  • Insert Size (bp)
    897
  • Promoter 2x35S
  • Tag / Fusion Protein
    • NLS (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gateway Cloning
  • 5′ sequencing primer atggcttcctcccctccaaaga
  • 3′ sequencing primer ctattaaaagtttatctcaccg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    us:NPTII repair template
  • Insert Size (bp)
    2600

Cloning Information for Gene/Insert 2

  • Cloning method Gateway Cloning
  • 5′ sequencing primer agcagtcttacttccatgatttc
  • 3′ sequencing primer tcagaagaactcgtcaagaa
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Zif268:FokI was amplified by PCR using pDW1345 as a template. This sequence was cloned into pNJB91. us:nptII repair template was amplified by PCR using pDW1269 as a template. This sequence was cloned into pNJB80. pNJB80 and pNJB91 with these two inserts were used in a multi-site Gateway reaction with pMDC32.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p35SZ.D was a gift from Daniel Voytas (Addgene plasmid # 51512 ; http://n2t.net/addgene:51512 ; RRID:Addgene_51512)
  • For your References section:

    DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792 10.1105/tpc.113.119792 PubMed 24443519