pCMV-myc-Sema4DdeltaC
(Plasmid
#51602)
-
Purposeexpresses Sema4D lacking C terminus
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51602 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 6300
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSema4DdeltaC
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2300
-
MutationLast 69 amino acids of Sema4D C-terminus are deleted.Silent mutations between amino acids (approx 275-281) to make resistant against shRNA1. Also silent mutation at aa 54-60 to make susceptible to shRNA2.
-
GenBank IDNM_001281880
-
Entrez GeneSema4d (a.k.a. CD100, Semacl2, Semaj, Semcl2, coll-4)
- Promoter CMV
-
Tag
/ Fusion Protein
- myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer TGTCAAGTTCAGGTGGTCACAGG
- 3′ sequencing primer TACAACTGCTACAAGGGCTAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the sequence of the myc epitope tag in this plasmid is MQKLISEEDLL, which differs from the standard EQKLISEEDLL.
The Sema4D insert in this plasmid does not contain amino acids 1-50 and contains a L745P mutation when compared to GenBank reference sequence NP_542764.2
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-myc-Sema4DdeltaC was a gift from Suzanne Paradis (Addgene plasmid # 51602 ; http://n2t.net/addgene:51602 ; RRID:Addgene_51602) -
For your References section:
Sema4D localizes to synapses and regulates GABAergic synapse development as a membrane-bound molecule in the mammalian hippocampus. Raissi AJ, Staudenmaier EK, David S, Hu L, Paradis S. Mol Cell Neurosci. 2013 Nov;57:23-32. doi: 10.1016/j.mcn.2013.08.004. Epub 2013 Sep 10. 10.1016/j.mcn.2013.08.004 PubMed 24036351