R5 PV
(Plasmid
#51734)
-
PurposeDicistronic vector with PV IRES
-
Depositing Lab
-
Depositing OrganizationScripps California (The Scripps Research Institute)
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51734 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 51734-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 51734-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGl4.13
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4600
- Total vector size (bp) 6396
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePV IRES
-
Insert Size (bp)816
- Promoter SV40
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site NcoI (not destroyed)
- 5′ sequencing primer TTCTAGAGCTTATCGATACC
- 3′ sequencing primer TGAAGGAGTCCAGCACGTTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
IRES is located immediately following the fLuc.
DNA (Catalog # 51734-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 51734-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
R5 PV was a gift from Vincent Mauro (Addgene plasmid # 51734 ; http://n2t.net/addgene:51734 ; RRID:Addgene_51734) -
For your References section:
Analysis of rRNA processing and translation in mammalian cells using a synthetic 18S rRNA expression system. Burman LG, Mauro VP. Nucleic Acids Res. 2012 Sep;40(16):8085-98. doi: 10.1093/nar/gks530. Epub 2012 Jun 20. 10.1093/nar/gks530 PubMed 22718970
Map uploaded by the depositor.
