Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

R5 PV
(Plasmid #51734)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51734 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGl4.13
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4600
  • Total vector size (bp) 6396

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PV IRES
  • Insert Size (bp)
    816
  • Promoter SV40

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site NcoI (not destroyed)
  • 5′ sequencing primer TTCTAGAGCTTATCGATACC
  • 3′ sequencing primer TGAAGGAGTCCAGCACGTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

IRES is located immediately following the fLuc.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    R5 PV was a gift from Vincent Mauro (Addgene plasmid # 51734 ; http://n2t.net/addgene:51734 ; RRID:Addgene_51734)
  • For your References section:

    Analysis of rRNA processing and translation in mammalian cells using a synthetic 18S rRNA expression system. Burman LG, Mauro VP. Nucleic Acids Res. 2012 Sep;40(16):8085-98. doi: 10.1093/nar/gks530. Epub 2012 Jun 20. 10.1093/nar/gks530 PubMed 22718970