-
PurposeThe oriP/EBV nuclear antigen (EBNA)-1 elements of Epstein-Barr virus is fused in frame with the luciferase in the herpes simplex virus type-1 amplicon vector, provides prolonged transgene expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51783 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHCAG amplicon vector
-
Backbone manufacturerpHCAG generated from our laboratory
- Backbone size w/o insert (bp) 7786
- Total vector size (bp) 13120
-
Modifications to backboneInsertion of luc2EBNA-1
-
Vector typeherpes simplex virus type-1 amplicon vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameLuciferase-2A-EBNA-1
-
Alt nameL2EOP
-
SpeciesEBV and firefly
-
Insert Size (bp)2972
- Promoter CAG
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site PacI (not destroyed)
- 5′ sequencing primer 5’ ATCATGTCTGACGAGGGCCC 3’
- 3′ sequencing primer 5’ GCTAGCCCTTTATGTGTAACTCTT 3’
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameOriP
-
Alt nameOriP
-
SpeciesEBV
-
Insert Size (bp)1973
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe EBNA-1/OriP elements were synthesized using PCR from pREP7 (Invitrogen).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
We would like to acknowledge, as a reference to depositing this plasmid, that the completed plasmid sequence is performed by Axil Scientific Sequencing , primer walking.
Addgene sequencing results find several discrepancies within the full plasmid sequence, they are not believed to effect the function of the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHCAG-L2EOP was a gift from Paula Lam (Addgene plasmid # 51783 ; http://n2t.net/addgene:51783 ; RRID:Addgene_51783) -
For your References section:
Hybrid herpes simplex virus/Epstein-Barr virus amplicon viral vectors confer enhanced transgene expression in primary human tumors and human bone marrow-derived mesenchymal stem cells. Sia KC, Chong WK, Ho IA, Yulyana Y, Endaya B, Huynh H, Lam PY. J Gene Med. 2010 Oct;12(10):848-58. doi: 10.1002/jgm.1506. 10.1002/jgm.1506 PubMed 20963807