Skip to main content

pcDNA3.1(+)-TTF-1-HDD
(Plasmid #52063)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52063 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Thyroid Transcription Factor 1
  • Alt name
    NKX2-1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    972
  • Mutation
    Homeodomain deleted
  • Entrez Gene
    NKX2-1 (a.k.a. BCH, BHC, NK-2, NKX2.1, NKX2A, NMTC1, T/EBP, TEBP, TITF1, TTF-1, TTF1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

When compared to GenBank reference sequence NP_003308.1, amino acids 171-221 were deleted to create this mutant. See the insert sequence provided by the depositing laboratory for the mutant TTF-1 protein sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1(+)-TTF-1-HDD was a gift from David Mu (Addgene plasmid # 52063 ; http://n2t.net/addgene:52063 ; RRID:Addgene_52063)
  • For your References section:

    Occludin is a direct target of thyroid transcription factor-1 (TTF-1/NKX2-1). Runkle EA, Rice SJ, Qi J, Masser D, Antonetti DA, Winslow MM, Mu D. J Biol Chem. 2012 Aug 17;287(34):28790-801. doi: 10.1074/jbc.M112.367987. Epub 2012 Jul 2. 10.1074/jbc.M112.367987 PubMed 22761434