-
PurposeConstitutive expression of humanized Cas9
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52223 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepART1
- Backbone size w/o insert (bp) 7333
- Total vector size (bp) 11750
-
Vector typeYeast Expression
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4430
-
Mutationsilent mutation in the original CspCI site
- Promoter adh1
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GGTGCCTTCGCTTTTCTT
- 3′ sequencing primer TGGAGGACTCGATTTAATGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAddgene
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMZ222 was a gift from Mikel Zaratiegui (Addgene plasmid # 52223 ; http://n2t.net/addgene:52223 ; RRID:Addgene_52223) -
For your References section:
Implementation of the CRISPR-Cas9 system in fission yeast. Jacobs JZ, Ciccaglione KM, Tournier V, Zaratiegui M. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344. 10.1038/ncomms6344 PubMed 25352017