Skip to main content

pCAG-hGPR56-IRES-GFP
(Plasmid #52297)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52297 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAGIG
  • Backbone size w/o insert (bp) 6135
  • Total vector size (bp) 8222
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human GPR56 coding sequence
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2082
  • Entrez Gene
    ADGRG1 (a.k.a. BFPP, BPPR, GPR56, TM7LN4, TM7XN1)
  • Promoter CAG promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (destroyed during cloning)
  • 3′ cloning site EcoRV (destroyed during cloning)
  • 5′ sequencing primer TGTGACCGGCGGCTCTAGAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-hGPR56-IRES-GFP was a gift from Christopher A Walsh (Addgene plasmid # 52297 ; http://n2t.net/addgene:52297 ; RRID:Addgene_52297)
  • For your References section:

    Evolutionarily dynamic alternative splicing of GPR56 regulates regional cerebral cortical patterning. Bae BI, Tietjen I, Atabay KD, Evrony GD, Johnson MB, Asare E, Wang PP, Murayama AY, Im K, Lisgo SN, Overman L, Sestan N, Chang BS, Barkovich AJ, Grant PE, Topcu M, Politsky J, Okano H, Piao X, Walsh CA. Science. 2014 Feb 14;343(6172):764-8. doi: 10.1126/science.1244392. 10.1126/science.1244392 PubMed 24531968