Skip to main content
Addgene

pTT5-hSDC1-N20
(Plasmid #52355)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52355 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTT5
  • Backbone manufacturer
    NRC Biotechnology Research Institute
  • Backbone size w/o insert (bp) 4401
  • Total vector size (bp) 5300
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SDC1
  • Alt name
    Syndecan-1 N20 or 'del 1- 20' truncation mutant
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    873
  • Mutation
    Deletion of SDC1 aa2-21 (according to numbering in Fig. 2A of associated publication) and replaced with GS; R117Q (R95Q numbering as in Fig. 2A)
  • Entrez Gene
    SDC1 (a.k.a. CD138, SDC, SYND1, syndecan)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer CCATACACTTGAGTGACAATGAC
  • 3′ sequencing primer TATGTCCTTCCGAGTGAGAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pTT5 backbone used in his plasmids was obtained from Yves Durocher at National Research Council of Canada (NRC)
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTT5-hSDC1-N20 was a gift from Gordon Laurie (Addgene plasmid # 52355 ; http://n2t.net/addgene:52355 ; RRID:Addgene_52355)
  • For your References section:

    Targeting of heparanase-modified syndecan-1 by prosecretory mitogen lacritin requires conserved core GAGAL plus heparan and chondroitin sulfate as a novel hybrid binding site that enhances selectivity. Zhang Y, Wang N, Raab RW, McKown RL, Irwin JA, Kwon I, van Kuppevelt TH, Laurie GW. J Biol Chem. 2013 Apr 26;288(17):12090-101. doi: 10.1074/jbc.M112.422717. Epub 2013 Mar 15. 10.1074/jbc.M112.422717 PubMed 23504321