Skip to main content

pTT5-hSDC1-2
(Plasmid #52378)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52378 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTT5
  • Backbone manufacturer
    NRC Biotechnology Research Institute
  • Backbone size w/o insert (bp) 4401
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SDC1
  • Alt name
    GAGAL of syndecan-1 replaced with of GADED of SDC2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    903
  • Mutation
    GAGAL of syndecan-1 replaced with of GADED of SDC2; L35W and R95Q (according to numbering in Fig. 2A of associated publication); Y309 and A310 deleted
  • Entrez Gene
    SDC1 (a.k.a. CD138, SDC, SYND1, syndecan)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer CCATACACTTGAGTGACAATGAC
  • 3′ sequencing primer TATGTCCTTCCGAGTGAGAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pTT5 backbone used in his plasmids was obtained from Yves Durocher at National Research Council of Canada (NRC)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note that the last 3 amino acids of hSDC1, ‘FYA’, in the cytoplasmic region is an important PDZ domain binding site. This was not an issue in the associated JBC article, but please be aware of the difference. The truncation of hSDC1 also removed the native stop codon and a portion of the beta-globin polyA signal.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTT5-hSDC1-2 was a gift from Gordon Laurie (Addgene plasmid # 52378 ; http://n2t.net/addgene:52378 ; RRID:Addgene_52378)
  • For your References section:

    Targeting of heparanase-modified syndecan-1 by prosecretory mitogen lacritin requires conserved core GAGAL plus heparan and chondroitin sulfate as a novel hybrid binding site that enhances selectivity. Zhang Y, Wang N, Raab RW, McKown RL, Irwin JA, Kwon I, van Kuppevelt TH, Laurie GW. J Biol Chem. 2013 Apr 26;288(17):12090-101. doi: 10.1074/jbc.M112.422717. Epub 2013 Mar 15. 10.1074/jbc.M112.422717 PubMed 23504321