PBRPyCAG-LoxP-ERAS-STOPcassette-Loxp-DsRed-IRES-PURO
(Plasmid
#52419)
-
PurposeConstitutive mammalian expression of ERAS. Upon CRE mediated deletion of ERAS insert, dsRED expression markers is truned on due to concomittant removal of stop cassette.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52419 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneaddgene 26274
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameERAS
-
SpeciesH. sapiens (human)
-
Entrez GeneERAS (a.k.a. HRAS2, HRASP)
- Promoter CAGGS
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (destroyed during cloning)
- 3′ cloning site Not1 (destroyed during cloning)
- 5′ sequencing primer GGGGACGGCTGCCTTCGGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PBRPyCAG-LoxP-ERAS-STOPcassette-Loxp-DsRed-IRES-PURO was a gift from Jacob Hanna (Addgene plasmid # 52419 ; http://n2t.net/addgene:52419 ; RRID:Addgene_52419) -
For your References section:
Derivation of novel human ground state naive pluripotent stem cells. Gafni O, Weinberger L, Mansour AA, Manor YS, Chomsky E, Ben-Yosef D, Kalma Y, Viukov S, Maza I, Zviran A, Rais Y, Shipony Z, Mukamel Z, Krupalnik V, Zerbib M, Geula S, Caspi I, Schneir D, Shwartz T, Gilad S, Amann-Zalcenstein D, Benjamin S, Amit I, Tanay A, Massarwa R, Novershtern N, Hanna JH. Nature. 2013 Dec 12;504(7479):282-6. doi: 10.1038/nature12745. Epub 2013 Oct 30. 10.1038/nature12745 PubMed 24172903