dVGlut-Gal80
(Plasmid
#52555)
-
PurposeExpresses Gal80 under vesicular glutamate transporter promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 52555 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBPGAL80Uw-6
- Backbone size w/o insert (bp) 9052
- Total vector size (bp) 15210
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVGlut-Gal80
-
Alt nameVGlut
-
Alt nameGal80
-
SpeciesD. melanogaster (fly), S. cerevisiae (budding yeast)
-
Insert Size (bp)6675
-
Entrez GeneVGlut (a.k.a. Dmel_CG9887, CG9887, DV-Glut, DVGLUT, DVGluT, DVGlut, Dmel\CG9887, DvGluT, DvGlut, MFS11, VGLUT, VGluT, Vglut, dVGLUT, dVGlut, dvGluT, dvGlut, dvglut, vGLUT, vGluT, vGlut, vglut)
-
Entrez GeneGAL80 (a.k.a. YML051W)
- Promoter Drosophila Synthetic Core Promoter
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TTGATTAATGTTGGCGCACG
- 3′ sequencing primer GAL80 R: GACTCCGCCTGATCGAGCGAGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byVGlut enhancer inserted by Gateway cloning into pBPGAL80Uw-6 (AddGene plasmid 26236)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene's quality control sequencing has found a number of discrepancies with the provided full plasmid sequence. These differences are not thought to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
dVGlut-Gal80 was a gift from Leslie Vosshall (Addgene plasmid # 52555 ; http://n2t.net/addgene:52555 ; RRID:Addgene_52555)