-
Purpose3rd generation lentiviral vector for enhanced eGFP expression/marking in primary B cells and B-cell lines
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 52633 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLeGO
- Backbone size w/o insert (bp) 6724
- Total vector size (bp) 8163
-
Modifications to backboneInsertion of hEµMAR-enhancer into SFFV-promoter
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsany (like TOP10, XL10-Gold or Stbl)
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehEµMAR-SFFV; eGFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GGGGAAAGAATAGTAGACATAATAGCA
- 3′ sequencing primer GACCAGGATGGGCACCAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPrimer-sequences for amplification of hEµMAR were kindly provided by X.M. Luo (California Institute of Technology, Pasadena, CA) and modified to clone into LeGO-G2. The eGFP cDNA is from Clontech. The lenti backbone is a derivative of pLentiLox3.7 developed at the MIT (http://web.mit.edu/jacks-lab/protocols/pll37.htm).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LeGO-hEµMAR-G2 was a gift from Boris Fehse (Addgene plasmid # 52633 ; http://n2t.net/addgene:52633 ; RRID:Addgene_52633) -
For your References section:
Efficient lentiviral transduction and transgene expression in primary human B cells. Mock U, Thiele R, Uhde A, Fehse B, Horn S. Hum Gene Ther Methods. 2012 Dec;23(6):408-15. doi: 10.1089/hgtb.2012.160. 10.1089/hgtb.2012.160 PubMed 23240650