pBICD2-TUG
(Plasmid
#52873)
-
Purposeretroviral expression of TUG
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 52873 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBICD2
-
Backbone manufacturerBogan lab, unpublished
- Backbone size w/o insert (bp) 7233
-
Modifications to backbonepBICD2 is identical to pMX-IRES-CD2 except that point mutations were introduced to eliminate two potential translation start sites 5' of the cloning site.
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTUG
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1600
-
Entrez GeneAspscr1 (a.k.a. 1190006K01Rik, ASPC, ASPCR1, ASPL, ASPS, RCC17, TUG)
- Promoter retrovirus LTR
-
Tag
/ Fusion Protein
- IRES-CD2 (mouse) (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer MX1 CCACCGCCCTCAAAGTAGACG
- 3′ sequencing primer pMI3 CCTAGATGCCATGGCCACTGTGC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The CD2 transmembrane and extracellular sequence are encoded in the vector, after the IRES, and used for selection in FACS (Liu et al Analytical Biochem 2000, PMID 10805516).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBICD2-TUG was a gift from Jonathan Bogan (Addgene plasmid # 52873 ; http://n2t.net/addgene:52873 ; RRID:Addgene_52873) -
For your References section:
Functional cloning of TUG as a regulator of GLUT4 glucose transporter trafficking. Bogan JS, Hendon N, McKee AE, Tsao TS, Lodish HF. Nature. 2003 Oct 16;425(6959):727-33. 10.1038/nature01989 PubMed 14562105