-
Purposeexpresses alpha hemolysin under the control of theophylline riboswitch
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 53116 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET21b
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5442
- Total vector size (bp) 6278
-
Modifications to backbonelacO and original RBS were removed from pET21b and substituted with the theophylline riboswitch
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nametheophylline riboswitch and alpha hemolysin
-
Alt namealpha hemolysin from Staphylococcus aureus
-
Alt nameαHL
-
SpeciesStaphylococcus aureus
-
Insert Size (bp)939
- Promoter T7 promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGCAGCACCCTGCTAAGGTAACAACAAG ATGGATTCTGATATCAATATCAAAACC
- 3′ sequencing primer AAG GGC ATC AAG ACG ATG CTG GTA TCA CCC TAT AGT GAG TCG TAT TAA TTT CGC GG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
JF001A was a gift from Sheref Mansy (Addgene plasmid # 53116 ; http://n2t.net/addgene:53116 ; RRID:Addgene_53116) -
For your References section:
Integrating artificial with natural cells to translate chemical messages that direct E. coli behaviour. Lentini R, Santero SP, Chizzolini F, Cecchi D, Fontana J, Marchioretto M, Del Bianco C, Terrell JL, Spencer AC, Martini L, Forlin M, Assfalg M, Dalla Serra M, Bentley WE, Mansy SS. Nat Commun. 2014 May 30;5:4012. doi: 10.1038/ncomms5012. 10.1038/ncomms5012 PubMed 24874202