pSUPER-retro-puro-tetO-CTR1-shRNA
(Plasmid
#53180)
-
PurposeExpresses shRNA against human CTR1 from puromycin resistance retroviral vector
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 53180 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSUPER-retro-puro-tetO
-
Backbone manufacturerOligoEngine
- Backbone size w/o insert (bp) 6349
-
Vector typeMammalian Expression, Retroviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCTR1
-
Alt nameSLC31A1
-
gRNA/shRNA sequenceAAAGCCCAGCTTTCTCTTTGG
-
SpeciesH. sapiens (human)
-
GenBank IDNM_001859.3
-
Entrez GeneSLC31A1 (a.k.a. COPT1, CTR1, NSCT)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (unknown if destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GGAAGCCTTGGCTTTTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSUPER-retro-puro-tetO-CTR1-shRNA was a gift from Christopher Counter (Addgene plasmid # 53180 ; http://n2t.net/addgene:53180 ; RRID:Addgene_53180) -
For your References section:
Copper is required for oncogenic BRAF signalling and tumorigenesis. Brady DC, Crowe MS, Turski ML, Hobbs GA, Yao X, Chaikuad A, Knapp S, Xiao K, Campbell SL, Thiele DJ, Counter CM. Nature. 2014 Apr 9. doi: 10.1038/nature13180. 10.1038/nature13180 PubMed 24717435