{Ud}RpL14.Dm
(Plasmid
#53220)
-
Purpose{Ud} is composed of two genes; (1) a UAS-RpL14.dsRNA targeting RNAi to a haploinsufficient gene RpL14 and (2) an RNAi insensitive RpL14 rescue
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 53220 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUASTattB
- Backbone size w/o insert (bp) 7365
-
Vector typeattB Drosophila melanogaster transformation
-
Selectable markersTransformation marker in Drosophila = white
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRpL14
-
SpeciesD. melanogaster (fly)
-
Mutation14 synonymous mutations introduced
-
Entrez GeneRpL14 (a.k.a. Dmel_CG6253, CG6253, Dmel\CG6253, L14, M(3), M(3)66, M(3)66D, M66D, RPL14, Rp L14, anon-EST:Posey193U, anon-EST:Posey6, rpl14)
- Promoter endogenous promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TTGAGATGCATCTACACAAGGAA
- 3′ sequencing primer TTGAGATGCATCTACACAAGGAA
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
complete information see
Reeves RG, Bryk J, Altrock PM, Denton J a., Reed FA: First steps towards underdominant genetic transformation of insect populations. PLoS One 2014.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
{Ud}RpL14.Dm was a gift from Diethard Tautz (Addgene plasmid # 53220 ; http://n2t.net/addgene:53220 ; RRID:Addgene_53220)