Skip to main content

pMyc-CMV1
(Plasmid #53582)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53582 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMyc-CMV1-huTLR4
  • Backbone manufacturer
    Dr. Golenbock, University of Massachusetts Medical School
  • Modifications to backbone
    pFLAG-CMV is from Sigma. Flag to Myc modified by Dr. Golenbock. huTLR4 was removed to make this plasmid.
  • Vector type
    Mammalian Expression
  • Promoter CMV
  • Tag / Fusion Protein
    • Myc (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer C-CMV-24 TATTAGGACAAGGCTGGTGGGCAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMyc-CMV1 was a gift from Linda Yu (Addgene plasmid # 53582 ; http://n2t.net/addgene:53582 ; RRID:Addgene_53582)
  • For your References section:

    LPS receptor subunits have antagonistic roles in epithelial apoptosis and colonic carcinogenesis. Kuo WT, Lee TC, Yang HY, Chen CY, Au YC, Lu YZ, Wu LL, Wei SC, Ni YH, Lin BR, Chen Y, Tsai YH, Kung JT, Sheu F, Lin LW, Yu LC. Cell Death Differ. 2015 Jan 30. doi: 10.1038/cdd.2014.240. 10.1038/cdd.2014.240 PubMed 25633197