pMiR-RECK-3'UTR
              
              
                (Plasmid
                
                #53614)
              
            
            
            
          - 
            PurposeLuciferase reporter assay for microRNA binding on the RECK 3'UTR
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 53614 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepMiR-Target
 - 
              Backbone manufacturerOrigene
 - Backbone size w/o insert (bp) 7900
 - Total vector size (bp) 9100
 - 
              Vector typeLuciferase
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberUnknown
 
Gene/Insert
- 
                Gene/Insert nameRECK-3'UTR
 - 
                    SpeciesH. sapiens (human)
 - 
                  Insert Size (bp)1229
 - 
                    GenBank IDNM_021111.2
 - 
                        Entrez GeneRECK (a.k.a. ST15)
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ cloning site EcoR1 (not destroyed)
 - 3′ cloning site Not1 (not destroyed)
 - 5′ sequencing primer AGAAGCTGCGCGGTGGTGTTGTG
 - 3′ sequencing primer CTGGAGGATCATCCAGCCGGCGT (Common Sequencing Primers)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pMiR-RECK-3'UTR was a gift from Edward Chan (Addgene plasmid # 53614 ; http://n2t.net/addgene:53614 ; RRID:Addgene_53614) - 
                
For your References section:
Keratinization-associated miR-7 and miR-21 regulate tumor suppressor reversion-inducing cysteine-rich protein with kazal motifs (RECK) in oral cancer. Jung HM, Phillips BL, Patel RS, Cohen DM, Jakymiw A, Kong WW, Cheng JQ, Chan EK. J Biol Chem. 2012 Aug 24;287(35):29261-72. doi: 10.1074/jbc.M112.366518. Epub 2012 Jul 2. 10.1074/jbc.M112.366518 PubMed 22761427