-
Purpose(Empty Backbone) Empty vector, integration at amyE, ampr, cmr
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 55168 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDG1662
-
Backbone manufacturerGuerout-Fleury, et al. 1996
-
Modifications to backbonepDG1662blamut was cut with PstI to remove one XbaI site and the spcR outside of the integrative part. The 6 kb fragment was religated. The remaining PstI site was mutated via site-directed mutagenesis. To insert the MCS, the vector was cut with EcoRI. The MCS was amplified by PCR from pSB1C3, cut with EcoRI and BsaI (EcoRI-compatible overhang) and ligated into the vector. The remaining NgoMIV sites were removed by subsequent site-directed mutagenesis.
-
Vector typeSynthetic Biology ; Bacillus BioBrick Box
-
Selectable markerschloramphenicol resistance in B. subtilis
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This is an “empty” vector that lacks promoters and reporter genes. The integrative part contains the flanking homology regions, a resistance cassette for selection in B. subtilis and the multiple cloning site (MCS), containing an rfp-cassette flanked by the restriction sites EcoRI, NotI, XbaI (upstream) and SpeI, NotI and PstI (downstream). They allow cloning in BioBrick standard with selection for white colonies as a result of the removal of the rfp-insert, which – if still present – leads to formation of red colonies in E. coli.
For sequencing of inserts, use the following primers:
fwd: AAAGGTCATTGTTGACGCGG
rev: GAGCGTAGCGAAAAATCC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBS1C was a gift from Thorsten Mascher (Addgene plasmid # 55168 ; http://n2t.net/addgene:55168 ; RRID:Addgene_55168) -
For your References section:
The Bacillus BioBrick Box: generation and evaluation of essential genetic building blocks for standardized work with Bacillus subtilis. Radeck J, Kraft K, Bartels J, Cikovic T, Durr F, Emenegger J, Kelterborn S, Sauer C, Fritz G, Gebhard S, Mascher T. J Biol Eng. 2013 Dec 2;7(1):29. doi: 10.1186/1754-1611-7-29. 10.1186/1754-1611-7-29 PubMed 24295448