Skip to main content
Addgene

pBS1ClacZ
(Plasmid #55171)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 55171 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAC6
  • Backbone manufacturer
    Stulke, et al 1997
  • Modifications to backbone
    pAC6blamut was cut with EcoRI and PstI. The primers TM2301 and TM2302 (1 pM) were mixed, heated (95°C, 10 min), re-annealed (50°C, 10 min) to become double stranded with 4 bp overhangs and ligated into the vector. The vector was cut with EcoRI and PstI and ligated with the MCS from pSB1C3 cut with EcoRI and PstI. A PstI site in the E. coli ori was removed by cutting with BglII and religation of the 11 kb fragment.
  • Vector type
    Synthetic Biology ; Bacillus BioBrick Box
  • Promoter none
  • Selectable markers
    chloramphenicol resistance in B. subtilis

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This reporter vector allows the measurement of promoter activity based on transcriptional fusions and mediates chloramphenicol resistance. It integrates into the amyE locus.

For sequencing of inserts, use the following primers:
fwd: TTTGAGCGTAGCGAAAAATCC
rev: CCCAGTCACGTTGTAAAACG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBS1ClacZ was a gift from Thorsten Mascher (Addgene plasmid # 55171 ; http://n2t.net/addgene:55171 ; RRID:Addgene_55171)
  • For your References section:

    The Bacillus BioBrick Box: generation and evaluation of essential genetic building blocks for standardized work with Bacillus subtilis. Radeck J, Kraft K, Bartels J, Cikovic T, Durr F, Emenegger J, Kelterborn S, Sauer C, Fritz G, Gebhard S, Mascher T. J Biol Eng. 2013 Dec 2;7(1):29. doi: 10.1186/1754-1611-7-29. 10.1186/1754-1611-7-29 PubMed 24295448