Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pAAV-hSyn Coff/Fon hChR2(H134R)-EYFP
(Plasmid #55648)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 55648 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV
  • Backbone size w/o insert (bp) 4800
  • Total vector size (bp) 6910
  • Vector type
    Mammalian Expression, AAV ; Cre off/Flp on ChR2-EYFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ChR2(H134R)-EYFP
  • Species
    Synthetic
  • Insert Size (bp)
    2110
  • Promoter hSyn
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer ccacgcgaggcgcgagatag
  • 3′ sequencing primer GCAATAGCATGATACAAAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn Coff/Fon hChR2(H134R)-EYFP was a gift from Karl Deisseroth (Addgene plasmid # 55648 ; http://n2t.net/addgene:55648 ; RRID:Addgene_55648)
  • For your References section:

    Targeting cells with single vectors using multiple-feature Boolean logic. Fenno LE, Mattis J, Ramakrishnan C, Hyun M, Lee SY, He M, Tucciarone J, Selimbeyoglu A, Berndt A, Grosenick L, Zalocusky KA, Bernstein H, Swanson H, Perry C, Diester I, Boyce FM, Bass CE, Neve R, Huang ZJ, Deisseroth K. Nat Methods. 2014 Jul;11(7):763-72. doi: 10.1038/nmeth.2996. Epub 2014 Jun 8. 10.1038/nmeth.2996 PubMed 24908100