Skip to main content

pTorPE-Y-GECO1
(Plasmid #55765)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 55765 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 4125
  • Vector type
    Bacterial Expression ; Lab constructed

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Y-GECO1.0
  • Alt name
    A yellow fluorescent calcium ion indicator with inverted fluorescent response
  • Species
    Synthetic
  • Insert Size (bp)
    1368
  • GenBank ID
    KJ193859
  • Promoter pBAD
  • Tag / Fusion Protein
    • 6x His tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The vector is modified from pBAD/ His B (Invitrogen).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTorPE-Y-GECO1 was a gift from Robert Campbell (Addgene plasmid # 55765 ; http://n2t.net/addgene:55765 ; RRID:Addgene_55765)
  • For your References section:

    Microfluidic cell sorter-aided directed evolution of a protein-based calcium ion indicator with an inverted fluorescent response. Zhao Y, Abdelfattah AS, Zhao Y, Ruangkittisakul A, Ballanyi K, Campbell RE, Harrison DJ. Integr Biol (Camb). 2014 May 19. 10.1039/c4ib00039k PubMed 24840546