-
PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. EFS Promoter driven
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 57818 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.005
- Total vector size (bp) 11707
-
Vector typeLentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameSpCas9
-
SpeciesS. pyogenes
-
Insert Size (bp)4300
- Promoter EFS
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site Nhei (not destroyed)
- 5′ sequencing primer ATAAGTGCAGTAGTCGCCGTG
- 3′ sequencing primer AAAGCAGCGTATCCACATAGC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSp sgRNA scaffold
-
Insert Size (bp)75
- Promoter hU6
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site PpuMI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TTTGCTGTACTTTCTATAGTG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameEFS
-
Alt nameshort EF1alpha Promoter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)250
-
Entrez GeneEEF1A1 (a.k.a. CCS-3, CCS3, EE1A1, EEF-1, EEF1A, EF-Tu, EF1A, EF1A1, EF1alpha1, GRAF-1EF, LENG7, PTI1, eEF1A-1)
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GGT ACA GTG CAG GGG AAA GAA TA
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameP2A-eGFP
-
SpeciesSynthetic
-
Insert Size (bp)750
Cloning Information for Gene/Insert 4
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer TACGAGACACGGATCGACCTG
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Use BsmBI sites for sgRNA cloning. Note that this plasmid does NOT contain the 1.9kb stuffer from the pLKO.005 vector backbone.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pL-CRISPR.EFS.GFP was a gift from Benjamin Ebert (Addgene plasmid # 57818 ; http://n2t.net/addgene:57818 ; RRID:Addgene_57818) -
For your References section:
Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Heckl D, Kowalczyk MS, Yudovich D, Belizaire R, Puram RV, McConkey ME, Thielke A, Aster JC, Regev A, Ebert BL. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951. 10.1038/nbt.2951 PubMed 24952903