Skip to main content
Addgene

pL-CRISPR.EFS.GFP
(Plasmid #57818)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 57818 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.005
  • Total vector size (bp) 11707
  • Vector type
    Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    SpCas9
  • Species
    S. pyogenes
  • Insert Size (bp)
    4300
  • Promoter EFS
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site Nhei (not destroyed)
  • 5′ sequencing primer ATAAGTGCAGTAGTCGCCGTG
  • 3′ sequencing primer AAAGCAGCGTATCCACATAGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Sp sgRNA scaffold
  • Insert Size (bp)
    75
  • Promoter hU6

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site PpuMI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TTTGCTGTACTTTCTATAGTG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    EFS
  • Alt name
    short EF1alpha Promoter
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    250
  • Entrez Gene
    EEF1A1 (a.k.a. CCS-3, CCS3, EE1A1, EEF-1, EEF1A, EF-Tu, EF1A, EF1A1, EF1alpha1, GRAF-1EF, LENG7, PTI1, eEF1A-1)

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GGT ACA GTG CAG GGG AAA GAA TA
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    P2A-eGFP
  • Species
    Synthetic
  • Insert Size (bp)
    750

Cloning Information for Gene/Insert 4

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer TACGAGACACGGATCGACCTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Use BsmBI sites for sgRNA cloning. Note that this plasmid does NOT contain the 1.9kb stuffer from the pLKO.005 vector backbone.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pL-CRISPR.EFS.GFP was a gift from Benjamin Ebert (Addgene plasmid # 57818 ; http://n2t.net/addgene:57818 ; RRID:Addgene_57818)
  • For your References section:

    Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Heckl D, Kowalczyk MS, Yudovich D, Belizaire R, Puram RV, McConkey ME, Thielke A, Aster JC, Regev A, Ebert BL. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951. 10.1038/nbt.2951 PubMed 24952903