pBabe-Neuroserpin
(Plasmid
#58259)
-
PurposeRetroviral vector for expressing Neuroserpin in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58259 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBABE-Puro
- Backbone size w/o insert (bp) 5169
- Total vector size (bp) 6774
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNeuroserpin
-
Alt nameSERPINI1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1605
-
GenBank IDBC018043.1
-
Entrez GeneSERPINI1 (a.k.a. HNS-S1, HNS-S2, PI12, neuroserpin)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer gtctctcccccttgaacctc
- 3′ sequencing primer ATGGCTTCCTCAGGGAAAGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBabe-Neuroserpin was a gift from Joan Massague (Addgene plasmid # 58259 ; http://n2t.net/addgene:58259 ; RRID:Addgene_58259) -
For your References section:
Serpins promote cancer cell survival and vascular co-option in brain metastasis. Valiente M, Obenauf AC, Jin X, Chen Q, Zhang XH, Lee DJ, Chaft JE, Kris MG, Huse JT, Brogi E, Massague J. Cell. 2014 Feb 27;156(5):1002-16. doi: 10.1016/j.cell.2014.01.040. 10.1016/j.cell.2014.01.040 PubMed 24581498