pACUH
(Plasmid
#58374)
-
Purpose(Empty Backbone) UAS vector to express gene of interest in Drosophila
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 58374 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepACU
-
Backbone manufacturerChun Han (Addgene plasmid 58373)
- Backbone size (bp) 9199
-
Modifications to backboneContains 10xUAS-Hsp70-MCS-SV40 (1268bp) cloned into BamHI site.
-
Vector typeInsect Expression
-
Selectable markersmini-white
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer ttgattaacccttagcatgtcc
- 3′ sequencing primer ttcagtgatgtccagtgcag (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information about the Han Lab Drosophila Transgenic Vectors, please visit: https://han.wicmb.cornell.edu/han-lab-drosophila-transgenic-vectors/.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACUH was a gift from Chun Han & Yuh-Nung Jan (Addgene plasmid # 58374 ; http://n2t.net/addgene:58374 ; RRID:Addgene_58374) -
For your References section:
Phosphatidylserine Externalization Results from and Causes Neurite Degeneration in Drosophila. Sapar ML, Ji H, Wang B, Poe AR, Dubey K, Ren X, Ni JQ, Han C. Cell Rep. 2018 Aug 28;24(9):2273-2286. doi: 10.1016/j.celrep.2018.07.095. 10.1016/j.celrep.2018.07.095 PubMed 30157423