-
PurposeMammalian expression of CFP targeted to the mitochondrial matrix
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 58426 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepclbw
-
Backbone manufacturergifted by C. Lois and D. Baltimore
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemito-CFP
- Promoter cmv-bactin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer TCTGCTAACCATGTTCATGCC
- 3′ sequencing primer AGCAGCGTATCCACATAGC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pclbw-mitoCFP was a gift from David Chan (Addgene plasmid # 58426 ; http://n2t.net/addgene:58426 ; RRID:Addgene_58426) -
For your References section:
Proteolytic cleavage of Opa1 stimulates mitochondrial inner membrane fusion and couples fusion to oxidative phosphorylation. Mishra P, Carelli V, Manfredi G, Chan DC. Cell Metab. 2014 Apr 1;19(4):630-41. doi: 10.1016/j.cmet.2014.03.011. 10.1016/j.cmet.2014.03.011 PubMed 24703695