FRP1639_PTEF-HygMX-TTEF-insul-(lexA-box)1-PminCYC1
(Plasmid
#58439)
-
PurposeCassette to replace yeast promoters with an inducible promoter containing 1 lexA box
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58439 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBS
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 2884
- Total vector size (bp) 4820
-
Vector typeYeast Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePTEF-HygMX-TTEF-insul-(lexA-box)1-PminCYC1
-
SpeciesSynthetic
-
Insert Size (bp)1936
- Promoter PTEF-HygMX-TTEF-insul-(lexA-box)1-PminCYC1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer AATTAACCCTCACTAAAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FRP1639_PTEF-HygMX-TTEF-insul-(lexA-box)1-PminCYC1 was a gift from Joerg Stelling (Addgene plasmid # 58439 ; http://n2t.net/addgene:58439 ; RRID:Addgene_58439) -
For your References section:
Inducible, tightly regulated and growth condition-independent transcription factor in Saccharomyces cerevisiae. Ottoz DS, Rudolf F, Stelling J. Nucleic Acids Res. 2014 Jul 17. pii: gku616. 10.1093/nar/gku616 PubMed 25034689