VV208: sdChR(C138S,E154A)-TS-eGFP-ER in fck
(Plasmid
#58511)
-
PurposeExpresses sdChR with the C138S (step function opsin) mutation and the E154A mutation fused to eGFP under the a-CamKII promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58511 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneFCK(1.3)GW, from Addgene 22217
- Backbone size w/o insert (bp) 9240
- Total vector size (bp) 10059
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsUse recombinase-free E. coli
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesdChR(C138S, E154A)-TS-eGFP-ER
-
Alt nameChannelrhodopsin from Scherffelia dubia
-
SpeciesScherffelia dubia
-
Insert Size (bp)1780
-
Mutationchanged Cysteine 138 to Serine; changed Glutamate 154 to Alanine
- Promoter a-CamKII
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GCTCGTCAATCAAGCTGGTTC
- 3′ sequencing primer CCACATAGCGTAAAAGGAGCAAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWe originally received this gene (sdChR) from Nathan Klapoetke in the Boyden Lab at MIT; the protein engineering leading to introduction of the E154A mutation is described in: Hochbaum, Zhao, Farhi, Klapoetke, et al. 2014. "All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins." Nature Methods (in press). We made the C138S point mutation in sdChR(E154A). Note that C138 in sdChR is homologous to C128 in ChR2; the ChR2(C128S) point mutant was first made by Berndt et al (reference: Bi-stable neural state switches. Berndt et al (Nat Neurosci. 2009 Feb. 12(2):229-34.)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
sdChR was first published in: Klapoetke, N. C., Y. Murata, S.S. Kim, S.R. Pulver, A. Birdsey-Benson, Y.K. Cho, T.K. Morimoto, A.S. Chuong, E.J. Carpenter and Z. Tian. 2014. Independent optical excitation of distinct neural populations. Nat. Meth. 11, 338-346.
sdChR(E154A) was first published in: Hochbaum, Zhao, Farhi, Klapoetke, et al. 2014. "All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins." Nature Methods (in press).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VV208: sdChR(C138S,E154A)-TS-eGFP-ER in fck was a gift from Adam Cohen (Addgene plasmid # 58511) -
For your References section:
Imaging GFP-Based Reporters in Neurons with Multiwavelength Optogenetic Control. Venkatachalam V, Cohen AE. Biophys J. 2014 Oct 7;107(7):1554-63. doi: 10.1016/j.bpj.2014.08.020. 10.1016/j.bpj.2014.08.020 PubMed 25296307