VV220: CoChR(C108S)-eGFP in fck
(Plasmid
#58512)
-
PurposeExpresses CoChR with the C108S (step function opsin) mutation fused to eGFP under the a-CamKII promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58512 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneFCK(1.3)GW, from Addgene 22217
- Backbone size w/o insert (bp) 9240
- Total vector size (bp) 10059
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsUse recombinase-free E. coli
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCoChR(C108S)-eGFP
-
Alt nameChannelrhodopsin from Chloromonas oogama
-
SpeciesChloromonas oogama
-
Insert Size (bp)1600
-
Mutationchanged Cysteine 108 to Serine
- Promoter a-CamKII
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GCTCGTCAATCAAGCTGGTTC
- 3′ sequencing primer CCACATAGCGTAAAAGGAGCAAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWe received this gene (CoChR) from Nathan Klapoetke in the Boyden Lab at MIT; we made the C108S point mutation in CoChR and cloned it into the fck vector. Note that C108 in CoChR is homologous to the C128 in ChR2; the ChR2(C128S) was first made by Berndt et al (reference: Bi-stable neural state switches. Berndt et al (Nat Neurosci. 2009 Feb. 12(2):229-34.)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CoChR was published in: Klapoetke, N. C., Y. Murata, S.S. Kim, S.R. Pulver, A. Birdsey-Benson, Y.K. Cho, T.K. Morimoto, A.S. Chuong, E.J. Carpenter and Z. Tian. 2014. Independent optical excitation of distinct neural populations. Nat. Meth. 11, 338-346.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VV220: CoChR(C108S)-eGFP in fck was a gift from Adam Cohen (Addgene plasmid # 58512 ; http://n2t.net/addgene:58512 ; RRID:Addgene_58512) -
For your References section:
Imaging GFP-Based Reporters in Neurons with Multiwavelength Optogenetic Control. Venkatachalam V, Cohen AE. Biophys J. 2014 Oct 7;107(7):1554-63. doi: 10.1016/j.bpj.2014.08.020. 10.1016/j.bpj.2014.08.020 PubMed 25296307