pMaster1
(Plasmid #58525)

• Purpose: Reprogram somatic cells to iPS cells
• Depositing Lab: Mario Capecchi
• Depositing Organization: University of Utah
  Located in United States of America
• Publication: Wu et al Proc Natl Acad Sci U S A. 2014 Jul 22;111(29):10678-83. doi: 10.1073/pnas.1409933111. Epub 2014 Jul 7.

Backbone

• Vector backbone: pCEP4

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: neo
• Insert Size (bp): 816

Gene/Insert 2

• Gene/Insert name: tk
• Insert Size (bp): 1131
• Promoter: CAG

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: GCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATT

Gene/Insert 3

• Gene/Insert name: oct4
• Species: H. sapiens (human)
• Insert Size (bp): 1317
• Entrez Gene: POU5F1 (a.k.a. OCT3, OCT4, OCT4Borf1, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4)

Gene/Insert 4

• Gene/Insert name: Klf4
• Species: H. sapiens (human)
• Insert Size (bp): 971
• Entrez Gene: KLF4 (a.k.a. EZF, GKLF)

Gene/Insert 5

• Gene/Insert name: Sox2
• Insert Size (bp): 1610
• Entrez Gene: SOX2 (a.k.a. ANOP3, MCOPS3)

Gene/Insert 6

• Gene/Insert name: myc
• Species: H. sapiens (human)
• Insert Size (bp): 1100
• Entrez Gene: MYC (a.k.a. MRTL, MYCC, bHLHe39, c-Myc)
• Promoter: EF1a

Cloning Information for Gene/Insert 6

• Cloning method: Unknown
• 5′ sequencing primer: CGAttaatTAAtcgtgaggctccggtgcccgtcagt

Gene/Insert 7

• Gene/Insert name: EBNA-1
• Insert Size (bp): 1923

Gene/Insert 8

• Gene/Insert name: Amp
• Insert Size (bp): 858

Gene/Insert 9

• Gene/Insert name: Lin28
• Species: H. sapiens (human)
• Insert Size (bp): 2647
• Entrez Gene: LIN28A (a.k.a. CSDD1, LIN-28, LIN28, ZCCHC1, lin-28A)

Gene/Insert 10

• Gene/Insert name: Nanog
• Species: H. sapiens (human)
• Insert Size (bp): 935
• Entrez Gene: NANOG
• Promoter: CAG

Cloning Information for Gene/Insert 10

• Cloning method: Unknown
• 5′ sequencing primer: TAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAA

Gene/Insert 11

• Gene/Insert name: IRES
• Insert Size (bp): 581

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 58525-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 58525-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.