pMRX-IP/Venus-rLC3
(Plasmid
#58740)
-
PurposeExpresses Venus-rLC3 in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58740 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMRXIP Venus-Ci2
-
Backbone manufacturerDr.Shoji Yamaoka of Tokyo Medical and Dental University
- Backbone size w/o insert (bp) 6600
-
Vector typeRetroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemicrotubule-associated protein 1 light chain 3 beta
-
Alt nameMap1lc3b
-
Alt nameLC3B
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)378
-
GenBank IDNM_022867.2
-
Entrez GeneMap1lc3b (a.k.a. LC3B, Map1lc3, Mpl3, zbs559)
-
Tag
/ Fusion Protein
- Venus (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGACCACTACCAGCAGAACA
- 3′ sequencing primer AAAAGACGGCAATATGGTGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byIt has the pMX backbone
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMRX-IP/Venus-rLC3 was a gift from Noboru Mizushima (Addgene plasmid # 58740 ; http://n2t.net/addgene:58740 ; RRID:Addgene_58740) -
For your References section:
Temporal analysis of recruitment of mammalian ATG proteins to the autophagosome formation site. Koyama-Honda I, Itakura E, Fujiwara TK, Mizushima N. Autophagy. 2013 Oct;9(10):1491-9. doi: 10.4161/auto.25529. Epub 2013 Jul 10. 10.4161/auto.25529 PubMed 23884233
Map uploaded by the depositor.
