-
Purposelabels macrophages with mcherry
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58935 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneTol2
- Backbone size w/o insert (bp) 3500
- Total vector size (bp) 6124
-
Modifications to backboneInserted mpeg1-mcherry
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namempeg1-mcherry
-
Insert Size (bp)2800
- Promoter mpeg1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site xhoI (not destroyed)
- 3′ cloning site xbaI (not destroyed)
- 5′ sequencing primer Gtgaaagtacaagtacttagggaaaa
- 3′ sequencing primer gtgtggaattgtgagcggataac (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
tol2-mpeg1-mcherry was a gift from Anna Huttenlocher (Addgene plasmid # 58935 ; http://n2t.net/addgene:58935 ; RRID:Addgene_58935)