-
PurposeExpression of preCOX4-mCherry & preSU9-GFP for colocalisation analysis of yeast mitochondrila
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 58980 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUG35
- Backbone size w/o insert (bp) 4872
- Total vector size (bp) 8213
-
Modifications to backboneNAT resistance
-
Vector typeYeast Expression
-
Selectable markersNourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)704
- Promoter ADH1
-
Tag
/ Fusion Protein
- preCOX4 (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BstBI (not destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer AATTGTGAGCGGATAACAATTTCA
- 3′ sequencing primer GTGCCACCTTTTCGACACTT
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGFP
-
Alt namemtGFP
-
SpeciesSynthetic
-
Insert Size (bp)716
- Promoter MET17
-
Tag
/ Fusion Protein
- preSU9 (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site EcoRV (destroyed during cloning)
- 5′ sequencing primer AAGTGTCGAAAAGGTGGCAC
- 3′ sequencing primer GTTTTCCCAGTCACGAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypYES_mtGFP: B. Westermann pHS12: C. Dunn
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMitoLOC was a gift from Markus Ralser (Addgene plasmid # 58980 ; http://n2t.net/addgene:58980 ; RRID:Addgene_58980) -
For your References section:
MitoLoc: A method for the simultaneous quantification of mitochondrial network morphology and membrane potential in single cells. Vowinckel J, Hartl J, Butler R, Ralser M. Mitochondrion. 2015 Sep;24:77-86. doi: 10.1016/j.mito.2015.07.001. Epub 2015 Jul 13. 10.1016/j.mito.2015.07.001 PubMed 26184437