pCCM936
(Plasmid
#58981)
-
PurposeExpresses avr-14 sgRNA in C.elegans.
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 58981 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCR-Blunt II-TOPO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 3519
- Total vector size (bp) 4359
-
Vector typeWorm Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameavr-14 sgRNA
-
Alt nameavr-14 guide
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)840
- Promoter U6
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer Sp6
- 3′ sequencing primer T7 (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA target sequence GATTGGAGAGTTAGACCACG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCCM936 was a gift from Craig Mello (Addgene plasmid # 58981 ; http://n2t.net/addgene:58981 ; RRID:Addgene_58981) -
For your References section:
A Co-CRISPR Strategy for Efficient Genome Editing in Caenorhabditis elegans. Kim H, Ishidate T, Ghanta KS, Seth M, Conte D Jr, Shirayama M, Mello CC. Genetics. 2014 May 30. pii: genetics.114.166389. 10.1534/genetics.114.166389 PubMed 24879462